| Title: | LncRNA Identification and Analysis Using Heterologous Features |
|---|---|
| Description: | Long non-coding RNAs identification and analysis. Default models are trained with human, mouse and wheat datasets by employing SVM. Features are based on intrinsic composition of sequence, EIIP value (electron-ion interaction pseudopotential), and secondary structure. This package can also extract other classic features and build new classifiers. Reference: Han S., et al. (2019) <doi:10.1093/bib/bby065>. |
| Authors: | Siyu Han [aut, cre], Ying Li [aut], Yanchun Liang [aut] |
| Maintainer: | Siyu Han <[email protected]> |
| License: | GPL-3 |
| Version: | 1.1.6 |
| Built: | 2026-06-12 10:18:16 UTC |
| Source: | https://github.com/cran/LncFinder |
This function is used to build new models with users' own data.
build_model( lncRNA.seq, mRNA.seq, frequencies.file, SS.features = FALSE, lncRNA.format = "DNA", mRNA.format = "DNA", parallel.cores = 2, folds.num = 10, seed = 1, gamma.range = (2^seq(-5, 0, 1)), cost.range = c(1, 4, 8, 16, 24, 32), ... )build_model( lncRNA.seq, mRNA.seq, frequencies.file, SS.features = FALSE, lncRNA.format = "DNA", mRNA.format = "DNA", parallel.cores = 2, folds.num = 10, seed = 1, gamma.range = (2^seq(-5, 0, 1)), cost.range = c(1, 4, 8, 16, 24, 32), ... )
lncRNA.seq |
Long non-coding sequences. Can be a FASTA file loaded by
|
mRNA.seq |
mRNA sequences. FASTA file loaded by |
frequencies.file |
String or a list obtained from function
|
SS.features |
Logical. If |
lncRNA.format |
String. Define the format of |
mRNA.format |
String. Define the format of |
parallel.cores |
Integer. The number of cores for parallel computation.
By default the number of cores is |
folds.num |
Integer. Specify the number of folds for cross-validation.
(Default: |
seed |
Integer. Used to set the seed for cross-validation. (Default: |
gamma.range |
The range of gamma. (Default: |
cost.range |
The range of cost. (Default: |
... |
Additional arguments passed to function |
This function is used to build a new model with users' own sequences.
Users can use function lnc_finder to predict the sequences with
new models.
For the details of frequencies.file, please refer to function
make_frequencies.
For the details of the features, please refer to function
extract_features.
For the details of svm tuning, please refer to function svm_tune.
Returns a svm model.
Siyu Han, Yanchun Liang, Qin Ma, Yangyi Xu, Yu Zhang, Wei Du, Cankun Wang & Ying Li. LncFinder: an integrated platform for long non-coding RNA identification utilizing sequence intrinsic composition, structural information, and physicochemical property. Briefings in Bioinformatics, 2019, 20(6):2009-2027.
HAN Siyu
make_frequencies, lnc_finder,
extract_features, svm_tune,
svm.
## Not run: data(demo_DNA.seq) Seqs <- demo_DNA.seq ### Build the model with pre-build frequencies.file: my_model <- build_model(lncRNA.seq = Seqs[1:5], mRNA.seq = Seqs[6:10], frequencies.file = "human", SS.features = FALSE, lncRNA.format = "DNA", mRNA.format = "DNA", parallel.cores = 2, folds.num = 2, seed = 1, gamma.range = (2 ^ seq(-5, -1, 2)), cost.range = c(2, 6, 12, 20)) ### Users can use default values of gamma.range and cost.range to find the ### best parameters. ### Use your own frequencies file by assigning frequencies list to parameter ### "frequencies.file". ## End(Not run)## Not run: data(demo_DNA.seq) Seqs <- demo_DNA.seq ### Build the model with pre-build frequencies.file: my_model <- build_model(lncRNA.seq = Seqs[1:5], mRNA.seq = Seqs[6:10], frequencies.file = "human", SS.features = FALSE, lncRNA.format = "DNA", mRNA.format = "DNA", parallel.cores = 2, folds.num = 2, seed = 1, gamma.range = (2 ^ seq(-5, -1, 2)), cost.range = c(2, 6, 12, 20)) ### Users can use default values of gamma.range and cost.range to find the ### best parameters. ### Use your own frequencies file by assigning frequencies list to parameter ### "frequencies.file". ## End(Not run)
This function can extract EIIP-derived features proposed by Han et al (2018).
compute_EIIP( Sequences, label = NULL, spectrum.percent = 0.1, quantile.probs = seq(0, 1, 0.25) )compute_EIIP( Sequences, label = NULL, spectrum.percent = 0.1, quantile.probs = seq(0, 1, 0.25) )
Sequences |
A FASTA file loaded by function |
label |
Optional. String. Indicate the label of the sequences such as "NonCoding", "Coding". |
spectrum.percent |
Numeric specifying the percentage of the sorted power spectrum that be
used to calculate the quantile-based features. For example, if |
quantile.probs |
Numeric. The probabilities with values in [0,1]. |
The function compute_EIIP can extract EIIP (electron-ion interaction pseudo-potential) features including:
signal at 1/3 position (Signal.Peak), average power (Average.Power), signal to noise ratio (SNR),
and quantile-based features of one specified percentage of the sorted power spectrum
(e.g. 0%, 20%, 40%, 60%, 70%,
100% when quantile.probs = seq(0, 1, 0.2) and spectrum.percent = 0.1).
In method LncFinder, EIIP features includes Signal.Peak, SNR, 0% (Signal.Min),
25% (Singal.Q1, 50% Signal.Q2), and 75% (Signal.Max) of the top 10% sorted
power spectrum, i.e. quantile.prob = seq(0, 1, 0.25) and spectrum.percent = 0.1.
A dataframe including the EIIP-derived features.
Siyu Han, Yanchun Liang, Qin Ma, Yangyi Xu, Yu Zhang, Wei Du, Cankun Wang & Ying Li. LncFinder: an integrated platform for long non-coding RNA identification utilizing sequence intrinsic composition, structural information, and physicochemical property. Briefings in Bioinformatics, 2019, 20(6):2009-2027.
Please cite the following paper, which originally proposed EIIP:
Lalović, Dragutin, and Veljko Veljković. The global average DNA base composition of coding regions may be determined by the electron-ion interaction potential. Biosystems, 1990, 23(4):311-316.
HAN Siyu
data(demo_DNA.seq) Seqs <- demo_DNA.seq EIIP_res <- compute_EIIP(Seqs, label = "NonCoding", spectrum.percent = 0.25, quantile.probs = seq(0, 1, 0.25))data(demo_DNA.seq) Seqs <- demo_DNA.seq EIIP_res <- compute_EIIP(Seqs, label = "NonCoding", spectrum.percent = 0.25, quantile.probs = seq(0, 1, 0.25))
This function can compute Euclidean Distance proposed by method LncFinder (Han et al. 2018). Euclidean Distance can be calculated on full sequence or the longest ORF region. The step and k of the sliding window can also be customized.
compute_EucDistance( Sequences, label = NULL, referFreq, k = 6, step = 1, alphabet = c("a", "c", "g", "t"), on.ORF = FALSE, auto.full = FALSE, parallel.cores = 2 )compute_EucDistance( Sequences, label = NULL, referFreq, k = 6, step = 1, alphabet = c("a", "c", "g", "t"), on.ORF = FALSE, auto.full = FALSE, parallel.cores = 2 )
Sequences |
A FASTA file loaded by function |
label |
Optional. String. Indicate the label of the sequences such as "NonCoding", "Coding". |
referFreq |
a list obtained from function |
k |
An integer that indicates the sliding window size. (Default: |
step |
Integer defaulting to |
alphabet |
A vector of single characters that specify the different character
of the sequence. (Default: |
on.ORF |
Logical. If |
auto.full |
Logical. When |
parallel.cores |
Integer. The number of cores for parallel computation.
By default the number of cores is |
This function can compute Euclidean Distance proposed by LncFinder (HAN et al. 2018).
In LncFinder, two schemes are provided to calculate Euclidean Distance:
1) step = 3 and k = 6 on the longest ORF region;
2) step = 1 and k = 6 on full sequence.
Using this function compute_EucDistance, both step, k,
and calculated region (full sequence or ORF)
can be customized to maximize its availability.
A dataframe.
Siyu Han, Yanchun Liang, Qin Ma, Yangyi Xu, Yu Zhang, Wei Du, Cankun Wang & Ying Li. LncFinder: an integrated platform for long non-coding RNA identification utilizing sequence intrinsic composition, structural information, and physicochemical property. Briefings in Bioinformatics, 2019, 20(6):2009-2027.
HAN Siyu
make_referFreq,
compute_LogDistance,
compute_hexamerScore.
## Not run: Seqs <- seqinr::read.fasta(file = "http://www.ncbi.nlm.nih.gov/WebSub/html/help/sample_files/nucleotide-sample.txt") referFreq <- make_referFreq(cds.seq = Seqs, lncRNA.seq = Seqs, k = 6, step = 3, alphabet = c("a", "c", "g", "t"), on.orf = TRUE, ignore.illegal = TRUE) data(demo_DNA.seq) Sequences <- demo_DNA.seq EucDistance <- compute_EucDistance(Sequences, label = "NonCoding", referFreq = referFreq, k = 6, step = 3, alphabet = c("a", "c", "g", "t"), on.ORF = TRUE, auto.full = TRUE, parallel.cores = 2) ## End(Not run)## Not run: Seqs <- seqinr::read.fasta(file = "http://www.ncbi.nlm.nih.gov/WebSub/html/help/sample_files/nucleotide-sample.txt") referFreq <- make_referFreq(cds.seq = Seqs, lncRNA.seq = Seqs, k = 6, step = 3, alphabet = c("a", "c", "g", "t"), on.orf = TRUE, ignore.illegal = TRUE) data(demo_DNA.seq) Sequences <- demo_DNA.seq EucDistance <- compute_EucDistance(Sequences, label = "NonCoding", referFreq = referFreq, k = 6, step = 3, alphabet = c("a", "c", "g", "t"), on.ORF = TRUE, auto.full = TRUE, parallel.cores = 2) ## End(Not run)
This function can compute Fickett TESTCODE score of DNA sequences proposed by James W.Fickett (Fickett JW. 1982). Fickett TESTCODE score can be calculated on full sequence or the longest ORF region.
compute_FickettScore( Sequences, label = NULL, on.ORF = FALSE, auto.full = FALSE, parallel.cores = 2 )compute_FickettScore( Sequences, label = NULL, on.ORF = FALSE, auto.full = FALSE, parallel.cores = 2 )
Sequences |
A FASTA file loaded by function |
label |
Optional. String. Indicate the label of the sequences such as "NonCoding", "Coding". |
on.ORF |
Logical. If |
auto.full |
Logical. When |
parallel.cores |
Integer. The number of cores for parallel computation.
By default the number of cores is |
This function can compute Fickett TESTCODE score proposed by James W.Fickett (Fickett JW. 1982).
Fickett TESTCODE score is selected as feature by method CPAT (Wang et al. 2013) and CPC2 (Kang et al. 2017).
In CPAT, Fickett TESTCODE score is calculated on the longest ORF region, but CPC2 calculates the score
on full sequence. This function compute_FickettScore improves the CPAT's code
and is capable of computing the score on the longest ORF region as well as full sequence.
A dataframe.
James W.Fickett. Recognition of protein coding regions in DNA sequences. Nucleic Acids Research, 1982, 10(17):5303-5318.
Siyu Han, Yanchun Liang, Qin Ma, Yangyi Xu, Yu Zhang, Wei Du, Cankun Wang & Ying Li. LncFinder: an integrated platform for long non-coding RNA identification utilizing sequence intrinsic composition, structural information, and physicochemical property. Briefings in Bioinformatics, 2019, 20(6):2009-2027.
Liguo Wang, Hyun Jung Park, Surendra Dasari, Shengqin Wang, JeanPierre Kocher & Wei Li. CPAT: coding-potential assessment tool using an alignment-free logistic regression model. Nucleic Acids Research, 2013, 41(6):e74-e74.
Yu-Jian Kang, De-Chang Yang, Lei Kong, Mei Hou, Yu-Qi Meng, Liping Wei & Ge Gao. CPC2: a fast and accurate coding potential calculator based on sequence intrinsic features. Nucleic Acids Research, 2017, 45(W1):W12-W16.
HAN Siyu
## Not run: data(demo_DNA.seq) Seqs <- demo_DNA.seq FickettScore <- compute_FickettScore(Seqs, label = NULL, on.ORF = TRUE, auto.full = TRUE, parallel.cores = 2) ## End(Not run)## Not run: data(demo_DNA.seq) Seqs <- demo_DNA.seq FickettScore <- compute_FickettScore(Seqs, label = NULL, on.ORF = TRUE, auto.full = TRUE, parallel.cores = 2) ## End(Not run)
This function can GC content of the input sequences.
compute_GC( Sequences, label = NULL, on.ORF = FALSE, auto.full = FALSE, parallel.cores = 2 )compute_GC( Sequences, label = NULL, on.ORF = FALSE, auto.full = FALSE, parallel.cores = 2 )
Sequences |
A FASTA file loaded by function |
label |
Optional. String. Indicate the label of the sequences such as "NonCoding", "Coding". |
on.ORF |
Logical. If |
auto.full |
Logical. When |
parallel.cores |
Integer. The number of cores for parallel computation.
By default the number of cores is |
This function can basically compute GC content of DNA sequences: GC content = (nc + ng) / (na + nc + ng + nt). The function will ignored the ambiguous bases.
A dataframe.
HAN Siyu
GC (package "seqinr-package")
## Not run: data(demo_DNA.seq) Seqs <- demo_DNA.seq gcContent <- compute_GC(Seqs, label = "NonCoding",on.ORF = TRUE, auto.full = TRUE, parallel.cores = 2) ## End(Not run)## Not run: data(demo_DNA.seq) Seqs <- demo_DNA.seq gcContent <- compute_GC(Seqs, label = "NonCoding",on.ORF = TRUE, auto.full = TRUE, parallel.cores = 2) ## End(Not run)
This function can compute hexamer score proposed by method CPAT (Wang et al. 2013). Hexamer score can be calculated on full sequence or the longest ORF region. The step and k of the sliding window can also be customized.
compute_hexamerScore( Sequences, label = NULL, referFreq, k = 6, step = 1, alphabet = c("a", "c", "g", "t"), on.ORF = FALSE, auto.full = FALSE, parallel.cores = 2 )compute_hexamerScore( Sequences, label = NULL, referFreq, k = 6, step = 1, alphabet = c("a", "c", "g", "t"), on.ORF = FALSE, auto.full = FALSE, parallel.cores = 2 )
Sequences |
A FASTA file loaded by function |
label |
Optional. String. Indicate the label of the sequences such as "NonCoding", "Coding". |
referFreq |
A list obtained from function |
k |
An integer that indicates the sliding window size. (Default: |
step |
Integer defaulting to |
alphabet |
A vector of single characters that specify the different character
of the sequence. (Default: |
on.ORF |
Logical. If |
auto.full |
Logical. When |
parallel.cores |
Integer. The number of cores for parallel computation.
By default the number of cores is |
This function can compute hexamer score proposed by CPAT (Wang et al. 2013).
In CPAT, hexamer score is calculated on the longest ORF region, and the step of the
sliding window is 3 (i.e. step = 3). Hexamer means six adjoining bases, thus
k = 6. But in function compute_hexamerScore, both step, k,
and calculated region (full sequence or ORF)
can be customized to maximize its availability.
A dataframe.
Liguo Wang, Hyun Jung Park, Surendra Dasari, Shengqin Wang, JeanPierre Kocher, & Wei Li. CPAT: coding-potential assessment tool using an alignment-free logistic regression model. Nucleic Acids Research, 2013, 41(6):e74-e74.
Siyu Han, Yanchun Liang, Qin Ma, Yangyi Xu, Yu Zhang, Wei Du, Cankun Wang & Ying Li. LncFinder: an integrated platform for long non-coding RNA identification utilizing sequence intrinsic composition, structural information, and physicochemical property. Briefings in Bioinformatics, 2019, 20(6):2009-2027.
HAN Siyu
make_referFreq,
compute_LogDistance,
compute_EucDistance.
## Not run: Seqs <- seqinr::read.fasta(file = "http://www.ncbi.nlm.nih.gov/WebSub/html/help/sample_files/nucleotide-sample.txt") referFreq <- make_referFreq(cds.seq = Seqs, lncRNA.seq = Seqs, k = 6, step = 1, alphabet = c("a", "c", "g", "t"), on.orf = TRUE, ignore.illegal = TRUE) data(demo_DNA.seq) Sequences <- demo_DNA.seq hexamerScore <- compute_hexamerScore(Sequences, label = "NonCoding", referFreq = referFreq, k = 6, step = 1, alphabet = c("a", "c", "g", "t"), on.ORF = TRUE, auto.full = TRUE, parallel.cores = 2) ## End(Not run)## Not run: Seqs <- seqinr::read.fasta(file = "http://www.ncbi.nlm.nih.gov/WebSub/html/help/sample_files/nucleotide-sample.txt") referFreq <- make_referFreq(cds.seq = Seqs, lncRNA.seq = Seqs, k = 6, step = 1, alphabet = c("a", "c", "g", "t"), on.orf = TRUE, ignore.illegal = TRUE) data(demo_DNA.seq) Sequences <- demo_DNA.seq hexamerScore <- compute_hexamerScore(Sequences, label = "NonCoding", referFreq = referFreq, k = 6, step = 1, alphabet = c("a", "c", "g", "t"), on.ORF = TRUE, auto.full = TRUE, parallel.cores = 2) ## End(Not run)
This function can calculate the k-mer frequencies of the sequences.
compute_kmer( Sequences, label = NULL, k = 1:5, step = 1, freq = TRUE, improved.mode = FALSE, alphabet = c("a", "c", "g", "t"), on.ORF = FALSE, auto.full = FALSE, parallel.cores = 2 )compute_kmer( Sequences, label = NULL, k = 1:5, step = 1, freq = TRUE, improved.mode = FALSE, alphabet = c("a", "c", "g", "t"), on.ORF = FALSE, auto.full = FALSE, parallel.cores = 2 )
Sequences |
A FASTA file loaded by function |
label |
Optional. String. Indicate the label of the sequences such as "NonCoding", "Coding". |
k |
An integer that indicates the sliding window size. (Default: |
step |
Integer defaulting to |
freq |
Logical. If TRUE, the frequencies of different patterns are returned
instead of counts. (Default: |
improved.mode |
Logical. If TRUE, the frequencies will be normalized using
the method proposed by PLEK (Li et al. 2014).
Ignored if |
alphabet |
A vector of single characters that specify the different character
of the sequence. (Default: |
on.ORF |
Logical. If |
auto.full |
Logical. When |
parallel.cores |
Integer. The number of cores for parallel computation.
By default the number of cores is |
This function can extract k-mer features. k and step can be customized.
The count (freq = FALSE) or frequencies (freq = TRUE) of different patterns can be returned.
If freq = TRUE, improved.mode is available. The improved mode is proposed by method PLEK.
(Ref: Li et al. 2014)
A dataframe.
HAN Siyu
## Not run: data(demo_DNA.seq) Seqs <- demo_DNA.seq kmer_res1 <- compute_kmer(Seqs, k = 1:5, step = 1, freq = TRUE, improved.mode = FALSE) kmer_res2 <- compute_kmer(Seqs, k = 1:5, step = 3, freq = TRUE, improved.mode = TRUE, on.ORF = TRUE, auto.full = TRUE) ## End(Not run)## Not run: data(demo_DNA.seq) Seqs <- demo_DNA.seq kmer_res1 <- compute_kmer(Seqs, k = 1:5, step = 1, freq = TRUE, improved.mode = FALSE) kmer_res2 <- compute_kmer(Seqs, k = 1:5, step = 3, freq = TRUE, improved.mode = TRUE, on.ORF = TRUE, auto.full = TRUE) ## End(Not run)
This function can compute Logarithm Distance proposed by method LncFinder (Han et al. 2018). Logarithm Distance can be calculated on full sequence or the longest ORF region. The step and k of the sliding window can also be customized.
compute_LogDistance( Sequences, label = NULL, referFreq, k = 6, step = 1, alphabet = c("a", "c", "g", "t"), on.ORF = FALSE, auto.full = FALSE, parallel.cores = 2 )compute_LogDistance( Sequences, label = NULL, referFreq, k = 6, step = 1, alphabet = c("a", "c", "g", "t"), on.ORF = FALSE, auto.full = FALSE, parallel.cores = 2 )
Sequences |
A FASTA file loaded by function |
label |
Optional. String. Indicate the label of the sequences such as "NonCoding", "Coding". |
referFreq |
a list obtained from function |
k |
An integer that indicates the sliding window size. (Default: |
step |
Integer defaulting to |
alphabet |
A vector of single characters that specify the different character
of the sequence. (Default: |
on.ORF |
Logical. If |
auto.full |
Logical. When |
parallel.cores |
Integer. The number of cores for parallel computation.
By default the number of cores is |
This function can compute Logarithm Distance proposed by LncFinder (HAN et al. 2018).
In LncFinder, two schemes are provided to calculate Logarithm Distance:
1) step = 3 and k = 6 on the longest ORF region;
2) step = 1 and k = 6 on full sequence.
Method LncFinder uses scheme 1 to extract Logarithm Distance features.
Using this function compute_EucDistance, both step, k,
and calculated region (full sequence or ORF)
can be customized to maximize its availability.
A dataframe.
Siyu Han, Yanchun Liang, Qin Ma, Yangyi Xu, Yu Zhang, Wei Du, Cankun Wang & Ying Li. LncFinder: an integrated platform for long non-coding RNA identification utilizing sequence intrinsic composition, structural information, and physicochemical property. Briefings in Bioinformatics, 2019, 20(6):2009-2027.
HAN Siyu
make_referFreq,
compute_EucDistance,
compute_hexamerScore.
## Not run: Seqs <- seqinr::read.fasta(file = "http://www.ncbi.nlm.nih.gov/WebSub/html/help/sample_files/nucleotide-sample.txt") referFreq <- make_referFreq(cds.seq = Seqs, lncRNA.seq = Seqs, k = 6, step = 3, alphabet = c("a", "c", "g", "t"), on.orf = TRUE, ignore.illegal = TRUE) data(demo_DNA.seq) Sequences <- demo_DNA.seq LogDistance <- compute_LogDistance(Sequences, label = "NonCoding", referFreq = referFreq, k = 6, step = 3, alphabet = c("a", "c", "g", "t"), on.ORF = TRUE, auto.full = TRUE, parallel.cores = 2) ## End(Not run)## Not run: Seqs <- seqinr::read.fasta(file = "http://www.ncbi.nlm.nih.gov/WebSub/html/help/sample_files/nucleotide-sample.txt") referFreq <- make_referFreq(cds.seq = Seqs, lncRNA.seq = Seqs, k = 6, step = 3, alphabet = c("a", "c", "g", "t"), on.orf = TRUE, ignore.illegal = TRUE) data(demo_DNA.seq) Sequences <- demo_DNA.seq LogDistance <- compute_LogDistance(Sequences, label = "NonCoding", referFreq = referFreq, k = 6, step = 3, alphabet = c("a", "c", "g", "t"), on.ORF = TRUE, auto.full = TRUE, parallel.cores = 2) ## End(Not run)
This function is basically a wrapper for function computePI.
This function translate DNA sequence into protein, and compute the theoretical isoelectric point
(pI) of this protein.
compute_pI( Sequences, label = NULL, on.ORF = FALSE, auto.full = FALSE, ambiguous.base = FALSE, parallel.cores = 2 )compute_pI( Sequences, label = NULL, on.ORF = FALSE, auto.full = FALSE, ambiguous.base = FALSE, parallel.cores = 2 )
Sequences |
A FASTA file loaded by function |
label |
Optional. String. Indicate the label of the sequences such as "NonCoding", "Coding". |
on.ORF |
Logical. If |
auto.full |
Logical. When |
ambiguous.base |
If |
parallel.cores |
Integer. The number of cores for parallel computation.
By default the number of cores is |
This function can compute the pI of DNA sequences. Method CPC2 (Kang et al. 2017) uses this feature to identify lncRNAs, and this feature is evaluated in the article LncFinder (Han et al. 2018).
Using this function, the theoretical pI can be computed on full sequence or the longest ORF region. In CPC2, pI is calculated on ORF region.
A dataframe.
HAN Siyu
## Not run: data(demo_DNA.seq) Sequences <- demo_DNA.seq pI_res <- compute_pI(Sequences, on.ORF = TRUE, auto.full = FALSE, ambiguous.base = FALSE) ## End(Not run)## Not run: data(demo_DNA.seq) Sequences <- demo_DNA.seq pI_res <- compute_pI(Sequences, on.ORF = TRUE, auto.full = FALSE, ambiguous.base = FALSE) ## End(Not run)
This dataset contains the features of 20 lncRNA sequences and 20 protein-coding sequences.
data(demo_dataset)data(demo_dataset)
A data frame with 40 rows and 20 variables:
the class of the sequences
the length of the longest ORF
the coverage of the longest ORF
Log-Distance.lncRNA
Log-Distance.protein-coding transcripts
Distance-Ratio.sequence
Signal as 1/3 position
Signal to noise ratio
the minimum value of the top 10% power spectrum
the quantile Q1 of the top 10% power spectrum
the quantile Q2 of the top 10% power spectrum
the maximum value of the top 10% power spectrum
Log-Distance.acguD.lncRNA
Log-Distance.acguD.protein-coding transcripts
Distance-Ratio.acguD
Log-Distance.acgu-ACGU.lncRNA
Log-Distance.acgu-ACGU.protein-coding transcripts
Distance-Ratio.acgu-ACGU
Minimum free energy
Percentage of Unpair-Pair
Sequences are selected from GENCODE.
This file contains 10 DNA sequences.
data(demo_DNA.seq)data(demo_DNA.seq)
A list contains 10 DNA sequences.
The sequences are loaded by function read.fasta.
DNA sequences are selected from GENCODE.
This file contains 10 SS (Secondary Structure) sequences.
data(demo_SS.seq)data(demo_SS.seq)
A data frame with 3 rows and 10 variables:
The first row is RNA sequence; the second row is Dot-Bracket Notation of secondary structure sequences; the last row is minimum free energy (MFE).
DNA sequences are selected from GENCODE. Secondary structure of each sequence is obtained from program "RNAfold".
This function can construct the dataset. This function is only used
to extract the features, please use function build_model to build
new models.
extract_features( Sequences, label = NULL, SS.features = FALSE, format = "DNA", frequencies.file = "human", parallel.cores = 2 )extract_features( Sequences, label = NULL, SS.features = FALSE, format = "DNA", frequencies.file = "human", parallel.cores = 2 )
Sequences |
mRNA sequences or long non-coding sequences. Can be a FASTA
file loaded by |
label |
Optional. String. Indicate the label of the sequences such as "NonCoding", "Coding". |
SS.features |
Logical. If |
format |
String. Can be |
frequencies.file |
String or a list obtained from function
|
parallel.cores |
Integer. The number of cores for parallel computation.
By default the number of cores is |
This function extracts the features and constructs the dataset.
Considering that it is time consuming to obtain secondary structure sequences,
users can build the model only with features of sequence and EIIP
(SS.features = FALSE). When SS.features = TRUE, Sequences
should be secondary structure sequences (Dot-Bracket Notation) obtained from
function run_RNAfold and parameter format should be set
as "SS".
Please note that:
Secondary structure features (SS.features) can improve the performance
when the species of unevaluated sequences is identical to the species of the
sequences that used to build the model.
However, if users are trying to predict sequences with the model trained on
other species, SS.features as TRUE may lead to low accuracy.
Returns a data.frame. 11 features when SS.features is FALSE,
and 19 features when SS.features is TRUE.
1. Features based on sequence:
The length and coverage of the longest ORF (ORF.Max.Len and
ORF.Max.Cov);
Log-Distance.lncRNA (Seq.lnc.Dist);
Log-Distance.protein-coding transcripts (Seq.pct.Dist);
Distance-Ratio.sequence (Seq.Dist.Ratio).
2. Features based on EIIP (electron-ion interaction pseudopotential) value:
Signal at 1/3 position (Signal.Peak);
Signal to noise ratio (SNR);
the minimum value of the top 10% power spectrum (Signal.Min);
the quantile Q1 and Q2 of the top 10% power spectrum (Singal.Q1
and Signal.Q2)
the maximum value of the top 10% power spectrum (Signal.Max).
3. Features based on secondary structure sequence:
Log-Distance.acguD.lncRNA (Dot_lnc.dist);
Log-Distance.acguD.protein-coding transcripts (Dot_pct.dist);
Distance-Ratio.acguD (Dot_Dist.Ratio);
Log-Distance.acgu-ACGU.lncRNA (SS.lnc.dist);
Log-Distance.acgu-ACGU.protein-coding transcripts (SS.pct.dist);
Distance-Ratio.acgu-ACGU (SS.Dist.Ratio);
Minimum free energy (MFE);
Percentage of Unpair-Pair (UP.PCT)
Siyu Han, Yanchun Liang, Qin Ma, Yangyi Xu, Yu Zhang, Wei Du, Cankun Wang & Ying Li. LncFinder: an integrated platform for long non-coding RNA identification utilizing sequence intrinsic composition, structural information, and physicochemical property. Briefings in Bioinformatics, 2019, 20(6):2009-2027.
HAN Siyu
svm_tune, build_model,
make_frequencies, run_RNAfold, read_SS.
## Not run: data(demo_DNA.seq) Seqs <- demo_DNA.seq ### Extract features with pre-build frequencies.file: my_features <- extract_features(Seqs, label = "Class.of.the.Sequences", SS.features = FALSE, format = "DNA", frequencies.file = "mouse", parallel.cores = 2) ### Use your own frequencies file by assign frequencies list to parameter ### "frequencies.file". ## End(Not run)## Not run: data(demo_DNA.seq) Seqs <- demo_DNA.seq ### Extract features with pre-build frequencies.file: my_features <- extract_features(Seqs, label = "Class.of.the.Sequences", SS.features = FALSE, format = "DNA", frequencies.file = "mouse", parallel.cores = 2) ### Use your own frequencies file by assign frequencies list to parameter ### "frequencies.file". ## End(Not run)
This function can find all the ORFs in one sequence.
find_orfs(OneSeq, reverse.strand = FALSE, max.only = TRUE)find_orfs(OneSeq, reverse.strand = FALSE, max.only = TRUE)
OneSeq |
Is one sequence. Can be a FASTA file read by package "seqinr"
|
reverse.strand |
Logical. Whether find ORF on the reverse strand. Default: |
max.only |
Logical. If |
This function can extract ORFs of one sequence. It returns
ORF region, length and coverage of the longest ORF when max.only = TRUE or
ORF region, start position, end position, length and coverage of all the ORFs when
max.only = FALSE. Coverage is the the ratio
of the ORF to transcript length. If reverse.strand = TRUE, ORF will also be
found on reverse strand.
If max.only = TRUE, the function returns a list which consists the ORF region (ORF.Max.Seq),
length (ORF.Max.Len) and coverage (ORF.Max.Cov) of the longest ORF.
If max.only = FALSE, the function returns a dataframe which consists all the ORF sequences.
HAN Siyu
### For one sequence: OneSeq <- c("cccatgcccagctagtaagcttagcc") orf.info_1 <- find_orfs(OneSeq, reverse.strand = TRUE, max.only = FALSE) ### For a FASTA file contains several sequences: ## Not run: ### Use "read.fasta" function of package "seqinr" to read a FASTA file: Seqs <- seqinr::read.fasta(file = "http://www.ncbi.nlm.nih.gov/WebSub/html/help/sample_files/nucleotide-sample.txt") ## End(Not run) ### Or just try to use our data "demo_DNA.seq" data(demo_DNA.seq) Seqs <- demo_DNA.seq ### Use apply function to find the longest ORF: orf.info_2 <- sapply(Seqs, find_orfs, reverse.strand = FALSE, max.only = FALSE)### For one sequence: OneSeq <- c("cccatgcccagctagtaagcttagcc") orf.info_1 <- find_orfs(OneSeq, reverse.strand = TRUE, max.only = FALSE) ### For a FASTA file contains several sequences: ## Not run: ### Use "read.fasta" function of package "seqinr" to read a FASTA file: Seqs <- seqinr::read.fasta(file = "http://www.ncbi.nlm.nih.gov/WebSub/html/help/sample_files/nucleotide-sample.txt") ## End(Not run) ### Or just try to use our data "demo_DNA.seq" data(demo_DNA.seq) Seqs <- demo_DNA.seq ### Use apply function to find the longest ORF: orf.info_2 <- sapply(Seqs, find_orfs, reverse.strand = FALSE, max.only = FALSE)
This function is used to predict sequences are non-coding transcripts or protein-coding transcripts.
lnc_finder( Sequences, SS.features = FALSE, format = "DNA", frequencies.file = "human", svm.model = "human", parallel.cores = 2 )lnc_finder( Sequences, SS.features = FALSE, format = "DNA", frequencies.file = "human", svm.model = "human", parallel.cores = 2 )
Sequences |
Unevaluated sequences. Can be a FASTA file loaded by
|
SS.features |
Logical. If |
format |
String. Define the format of the |
frequencies.file |
String or a list obtained from function
|
svm.model |
String or a svm model obtained from function |
parallel.cores |
Integer. The number of cores for parallel computation.
By default the number of cores is |
Considering that it is time consuming to obtain secondary structure
sequences, users can input nucleotide sequences and predict these sequences
without secondary structure features (Set SS.features as FALSE).
Please note that:
SS.features can improve the performance when the species of unevaluated
sequences is identical to the species of the sequences that used to build the
model.
However, if users are trying to predict sequences with the model trained on
other species, SS.features may lead to low accuracy.
For the details of frequencies.file, please refer to function
make_frequencies.
For the details of the features, please refer to function
extract_features.
Returns a data.frame. Including the results of prediction (Pred);
coding potential (Coding.Potential) and the features. For the details
of the features, please refer to function extract_features.
Siyu Han, Yanchun Liang, Qin Ma, Yangyi Xu, Yu Zhang, Wei Du, Cankun Wang & Ying Li. LncFinder: an integrated platform for long non-coding RNA identification utilizing sequence intrinsic composition, structural information, and physicochemical property. Briefings in Bioinformatics, 2019, 20(6):2009-2027.
HAN Siyu
build_model, make_frequencies,
extract_features, run_RNAfold, read_SS.
## Not run: data(demo_DNA.seq) Seqs <- demo_DNA.seq ### Input one sequence: OneSeq <- Seqs[1] result_1 <- lnc_finder(OneSeq, SS.features = FALSE, format = "DNA", frequencies.file = "human", svm.model = "human", parallel.cores = 2) ### Or several sequences: data(demo_SS.seq) Seqs <- demo_SS.seq result_2 <- lnc_finder(Seqs, SS.features = TRUE, format = "SS", frequencies.file = "mouse", svm.model = "mouse", parallel.cores = 2) ### A complete work flow: ### Calculate second structure on Windows OS, RNAfold.path <- '"E:/Program Files/ViennaRNA/RNAfold.exe"' SS.seq <- run_RNAfold(Seqs, RNAfold.path = RNAfold.path, parallel.cores = 2) ### Predict the sequences with secondary structure features, result_2 <- lnc_finder(SS.seq, SS.features = TRUE, format = "SS", frequencies.file = "mouse", svm.model = "mouse", parallel.cores = 2) ### Predict sequences with your own model by assigning a new svm.model and ### frequencies.file to parameters "svm.model" and "frequencies.file" ## End(Not run)## Not run: data(demo_DNA.seq) Seqs <- demo_DNA.seq ### Input one sequence: OneSeq <- Seqs[1] result_1 <- lnc_finder(OneSeq, SS.features = FALSE, format = "DNA", frequencies.file = "human", svm.model = "human", parallel.cores = 2) ### Or several sequences: data(demo_SS.seq) Seqs <- demo_SS.seq result_2 <- lnc_finder(Seqs, SS.features = TRUE, format = "SS", frequencies.file = "mouse", svm.model = "mouse", parallel.cores = 2) ### A complete work flow: ### Calculate second structure on Windows OS, RNAfold.path <- '"E:/Program Files/ViennaRNA/RNAfold.exe"' SS.seq <- run_RNAfold(Seqs, RNAfold.path = RNAfold.path, parallel.cores = 2) ### Predict the sequences with secondary structure features, result_2 <- lnc_finder(SS.seq, SS.features = TRUE, format = "SS", frequencies.file = "mouse", svm.model = "mouse", parallel.cores = 2) ### Predict sequences with your own model by assigning a new svm.model and ### frequencies.file to parameters "svm.model" and "frequencies.file" ## End(Not run)
This function is used to calculate the frequencies of lncRNAs, CDs, and
secondary structure sequences. The frequencies file can be used to build the classifier
using function extract_features. Functions make_frequencies and
extract_features are useful when users are trying
to build their own model.
NOTE: Function make_frequencies makes the frequencies file
for building the classifiers of LncFinder method. If users need to calculate Logarithm-Distance,
Euclidean-Distance, and hexamer score, the frequencies file need to be computed using function
make_referFreq.
make_frequencies( cds.seq, mRNA.seq, lncRNA.seq, SS.features = FALSE, cds.format = "DNA", lnc.format = "DNA", check.cds = TRUE, ignore.illegal = TRUE )make_frequencies( cds.seq, mRNA.seq, lncRNA.seq, SS.features = FALSE, cds.format = "DNA", lnc.format = "DNA", check.cds = TRUE, ignore.illegal = TRUE )
cds.seq |
Coding sequences (mRNA without UTRs). Can be a FASTA file loaded
by |
mRNA.seq |
mRNA sequences with Dot-Bracket Notation. The secondary
structure sequences can be obtained from function |
lncRNA.seq |
Long non-coding RNA sequences. Can be a FASTA file loaded by
|
SS.features |
Logical. If |
cds.format |
String. Define the format of the sequences of |
lnc.format |
String. Define the format of lncRNAs ( |
check.cds |
Logical. Incomplete CDs can lead to a false shift and a
inaccurate hexamer frequencies. When |
ignore.illegal |
Logical. If |
This function is used to make frequencies file for LncFinder method. This file is needed when users are trying to build their own model.
In order to achieve high accuracy, mRNA should not be regarded as CDs and assigned
to parameter cds.seq. However, CDs of some species may be insufficient
for calculating frequencies, and mRNAs can be regarded as CDs with parameter
check.cds = TRUE. In this case, hexamer frequencies will be calculated
on ORF region.
Considering that it is time consuming to obtain secondary structure sequences,
users can only provide nucleotide sequences and build a model without secondary
structure features (SS.features = FALSE). If users want to build a model
with secondary structure features, parameter SS.features should be set
as TRUE. At the same time, the format of the sequences of mRNA.seq
and lnc.seq should be secondary structure sequences (Dot-Bracket Notation).
Secondary structure sequences can be obtained by function run_RNAfold.
Please note that:
SS.features can improve the performance when the species of unevaluated sequences is identical to the species of the sequences that used to build the model.
However, if users are trying to predict sequences with the model trained on other species, SS.features may lead to low accuracy.
The frequencies file consists three groups: Hexamer Frequencies; acgu-ACGU Frequencies and acguD Frequencies.
Hexamer Frequencies are calculated on the original nucleotide sequences by employing k-mer scheme (k = 6), and the sliding window will slide 3 nt each step.
For any secondary structure sequences (Dot-Bracket Notation), if one position is a dot, the corresponding nucleotide of the RNA sequence will be replaced with character "D". acguD Frequencies are the k-mer frequencies (k = 4) calculated on this new sequences.
Similarly, for any secondary structure sequences (Dot-Bracket Notation), if one position is "(" or ")", the corresponding nucleotide of the RNA sequence will be replaced with upper case ("A", "C", "G", "U").
A brief example,
DNA Sequence: 5'- t a c a g t t a t g -3'
RNA Sequence: 5'- u a c a g u u a u g -3'
Dot-Bracket Sequence: 5'- . . . . ( ( ( ( ( ( -3'
acguD Sequence: { D, D, D, D, g, u, u, a, u, g }
acgu-ACGU Sequence: { u, a, c, a, G, U, U, A, U, G }
Returns a list which consists the frequencies of protein-coding sequences and non-coding sequences.
Siyu Han, Yanchun Liang, Qin Ma, Yangyi Xu, Yu Zhang, Wei Du, Cankun Wang & Ying Li. LncFinder: an integrated platform for long non-coding RNA identification utilizing sequence intrinsic composition, structural information, and physicochemical property. Briefings in Bioinformatics, 2019, 20(6):2009-2027.
HAN Siyu
run_RNAfold, read_SS,
build_model, extract_features,
make_referFreq.
### Only for examples: data(demo_DNA.seq) Seqs <- demo_DNA.seq ## Not run: ### Obtain the secondary structure sequences (Windows OS): RNAfold.path <- '"E:/Program Files/ViennaRNA/RNAfold.exe"' SS.seq <- run_RNAfold(Seqs, RNAfold.path = RNAfold.path, parallel.cores = 2) ### Make frequencies file with secondary strucutre features, my_file_1 <- make_frequencies(cds.seq = SS.seq, mRNA.seq = SS.seq, lncRNA.seq = SS.seq, SS.features = TRUE, cds.format = "SS", lnc.format = "SS", check.cds = TRUE, ignore.illegal = FALSE) ## End(Not run) ### Make frequencies file without secondary strucutre features, my_file_2 <- make_frequencies(cds.seq = Seqs, lncRNA.seq = Seqs, SS.features = FALSE, cds.format = "DNA", lnc.format = "DNA", check.cds = TRUE, ignore.illegal = FALSE) ### The input of cds.seq and lncRNA.seq can also be secondary structure ### sequences when SS.features = FALSE, such as, data(demp_SS.seq) SS.seq <- demo_SS.seq my_file_3 <- make_frequencies(cds.seq = SS.seq, lncRNA.seq = Seqs, SS.features = FALSE, cds.format = "SS", lnc.format = "DNA", check.cds = TRUE, ignore.illegal = FALSE)### Only for examples: data(demo_DNA.seq) Seqs <- demo_DNA.seq ## Not run: ### Obtain the secondary structure sequences (Windows OS): RNAfold.path <- '"E:/Program Files/ViennaRNA/RNAfold.exe"' SS.seq <- run_RNAfold(Seqs, RNAfold.path = RNAfold.path, parallel.cores = 2) ### Make frequencies file with secondary strucutre features, my_file_1 <- make_frequencies(cds.seq = SS.seq, mRNA.seq = SS.seq, lncRNA.seq = SS.seq, SS.features = TRUE, cds.format = "SS", lnc.format = "SS", check.cds = TRUE, ignore.illegal = FALSE) ## End(Not run) ### Make frequencies file without secondary strucutre features, my_file_2 <- make_frequencies(cds.seq = Seqs, lncRNA.seq = Seqs, SS.features = FALSE, cds.format = "DNA", lnc.format = "DNA", check.cds = TRUE, ignore.illegal = FALSE) ### The input of cds.seq and lncRNA.seq can also be secondary structure ### sequences when SS.features = FALSE, such as, data(demp_SS.seq) SS.seq <- demo_SS.seq my_file_3 <- make_frequencies(cds.seq = SS.seq, lncRNA.seq = Seqs, SS.features = FALSE, cds.format = "SS", lnc.format = "DNA", check.cds = TRUE, ignore.illegal = FALSE)
This function is used to calculate the frequencies of lncRNAs and CDs.
The Frequencies file can be used to calculate Logarithm-Distance (compute_LogDistance),
Euclidean-Distance (compute_EucDistance), and hexamer score (compute_hexamerScore).
NOTE: If users need to make frequencies file to build
new LncFinder classifier using function extract_features,
please refer to function make_frequencies.
make_referFreq( cds.seq, lncRNA.seq, k = 6, step = 1, alphabet = c("a", "c", "g", "t"), on.orf = TRUE, ignore.illegal = TRUE )make_referFreq( cds.seq, lncRNA.seq, k = 6, step = 1, alphabet = c("a", "c", "g", "t"), on.orf = TRUE, ignore.illegal = TRUE )
cds.seq |
Coding sequences (mRNA without UTRs). Can be a FASTA file loaded
by |
lncRNA.seq |
Long non-coding RNA sequences. Can be a FASTA file loaded by
|
k |
An integer that indicates the sliding window size. (Default: |
step |
Integer defaulting to |
alphabet |
A vector of single characters that specify the different character
of the sequence. (Default: |
on.orf |
Logical. Incomplete CDs can lead to a false shift and a
inaccurate hexamer frequencies. When |
ignore.illegal |
Logical. If |
This function is used to make frequencies file for the computation of
Logarithm-Distance (compute_LogDistance), Euclidean-Distance
(compute_EucDistance),
and hexamer score (compute_hexamerScore).
In order to achieve high accuracy, mRNA should not be regarded as CDs and assigned
to parameter cds.seq. However, CDs of some species may be insufficient
for calculating frequencies. In that case, mRNAs can be regarded as CDs with parameter
on.orf = TRUE, and the frequencies will be calculated on ORF region.
If on.orf = TRUE, users can set step = 3 to simulate the translation process.
Returns a list which consists the frequencies of protein-coding sequences and non-coding sequences.
Siyu Han, Yanchun Liang, Qin Ma, Yangyi Xu, Yu Zhang, Wei Du, Cankun Wang & Ying Li. LncFinder: an integrated platform for long non-coding RNA identification utilizing sequence intrinsic composition, structural information, and physicochemical property. Briefings in Bioinformatics, 2019, 20(6):2009-2027.
HAN Siyu
make_frequencies,
compute_LogDistance,
compute_EucDistance,
compute_hexamerScore.
## Not run: Seqs <- seqinr::read.fasta(file = "http://www.ncbi.nlm.nih.gov/WebSub/html/help/sample_files/nucleotide-sample.txt") referFreq <- make_referFreq(cds.seq = Seqs, lncRNA.seq = Seqs, k = 6, step = 1, alphabet = c("a", "c", "g", "t"), on.orf = TRUE, ignore.illegal = TRUE) ## End(Not run)## Not run: Seqs <- seqinr::read.fasta(file = "http://www.ncbi.nlm.nih.gov/WebSub/html/help/sample_files/nucleotide-sample.txt") referFreq <- make_referFreq(cds.seq = Seqs, lncRNA.seq = Seqs, k = 6, step = 1, alphabet = c("a", "c", "g", "t"), on.orf = TRUE, ignore.illegal = TRUE) ## End(Not run)
This function can read secondary structure information from your
own file instead of obtaining from function run_RNAfold. This function
will be useful if users have had secondary structure sequences (Dot-Bracket Notation).
read_SS( oneFile.loc, seqRNA.loc, seqSS.loc, separateFile = TRUE, withMFE = TRUE )read_SS( oneFile.loc, seqRNA.loc, seqSS.loc, separateFile = TRUE, withMFE = TRUE )
oneFile.loc |
String. The location of your sequence file. This file should contains
one (and only one) RNA sequence and its secondary structure sequence in Dot-Bracket Notation.
This parameter needs to be defined only when |
seqRNA.loc |
String. The location of your RNA sequences file (FASTA format). If your
RNA sequences and secondary structure sequences are in two files, you need to define the
locations of two files respectively. And the files with multiple sequences are supported
for this option. This parameter needs to be defined only when |
seqSS.loc |
String. The location of your secondary structure sequences file (FASTA format). |
separateFile |
Logical. Your RNA sequence(s) and secondary structure sequence(s) are in
separate files? If |
withMFE |
Logical. Whether MFE is provided at the end of secondary structure sequence.
If |
When users want to predict sequences with secondary structure features, users may have
had their own secondary structure sequences. With this function, users can read SS information
from their files. Two kind of files are supported: RNA sequence and SS sequence in one file
separateFile is FALSE or in separate files separateFile = TRUE.
separateFile = FALSE is used for secondary structure that obtained from some popular
programs, such as RNAfold. In this case, the output file only contains one RNA sequence and
its SS. Besides, this file only have two rows: RNA sequence and its SS sequences. Thus, this
option is more favorable when the file only have one sequence and the sequence are in accordance
with the output format of RNAfold.
If users obtained the SS sequence from experiments, RNA sequence and SS sequence may be in two
files. In this case, users can select separateFile = TRUE. Two files should be in FASTA
format and one file can have multiple sequences. The sequences in two files should have the same
order. If your data are obtained from experiments or other sources, it is highly recommended
that users should build new model with this data, since the SS sequences of pre-built model are
obtained for RNAfold and may have many differences with experimental data.
A dataframe. The first row is RNA sequence, the second row is Dot-Bracket Notation of secondary structure sequence, the third row is MFE (if MFE is provided).
HAN Siyu
## Not run: ### Load sequence data data("demo_DNA.seq") Seqs <- demo_DNA.seq[1:4] ### Convert sequences from vector to string. Seqs <- sapply(Seqs, seqinr::getSequence, as.string = TRUE) ### Write a fasta file. seqinr::write.fasta(Seqs, names = names(Seqs), file.out = "tmp.RNA.fa", as.string = TRUE) ### For Windows system: (Your path of RNAfold.) RNAfold.path <- '"E:/Program Files/ViennaRNA/RNAfold.exe"' ### Define the parameters of RNAfold. See documents of RNAfold for more information. RNAfold.command <- paste(RNAfold.path, " --noPS -i tmp.RNA.fa -o output", sep = "") ### Run RNAfold and output four result files. system(RNAfold.command) ### Read secondary structure information for one file. result_1 <- read_SS(oneFile.loc = "output_ENST00000510062.1.fold", separateFile = FALSE, withMFE = TRUE) ### Read secondary sturcture sequences for multiple files. filePath <- dir(pattern = ".fold") result_2 <- sapply(filePath, read_SS, separateFile = FALSE, withMFE = TRUE) result_2 <- as.data.frame(result_2) ## End(Not run)## Not run: ### Load sequence data data("demo_DNA.seq") Seqs <- demo_DNA.seq[1:4] ### Convert sequences from vector to string. Seqs <- sapply(Seqs, seqinr::getSequence, as.string = TRUE) ### Write a fasta file. seqinr::write.fasta(Seqs, names = names(Seqs), file.out = "tmp.RNA.fa", as.string = TRUE) ### For Windows system: (Your path of RNAfold.) RNAfold.path <- '"E:/Program Files/ViennaRNA/RNAfold.exe"' ### Define the parameters of RNAfold. See documents of RNAfold for more information. RNAfold.command <- paste(RNAfold.path, " --noPS -i tmp.RNA.fa -o output", sep = "") ### Run RNAfold and output four result files. system(RNAfold.command) ### Read secondary structure information for one file. result_1 <- read_SS(oneFile.loc = "output_ENST00000510062.1.fold", separateFile = FALSE, withMFE = TRUE) ### Read secondary sturcture sequences for multiple files. filePath <- dir(pattern = ".fold") result_2 <- sapply(filePath, read_SS, separateFile = FALSE, withMFE = TRUE) result_2 <- as.data.frame(result_2) ## End(Not run)
This function can compute secondary structure sequences. The tool "RNAfold" of software "ViennaRNA" is required for this function.
run_RNAfold(Sequences, RNAfold.path = "RNAfold", parallel.cores = 2)run_RNAfold(Sequences, RNAfold.path = "RNAfold", parallel.cores = 2)
Sequences |
A FASTA file loaded by function |
RNAfold.path |
String. Indicate the path of the program "RNAfold". By
default is |
parallel.cores |
Integer. The number of cores for parallel computation.
By default the number of cores is |
This function is used to compute secondary structure. The output of
this function can be used in function make_frequencies,
extract_features, build_model and
lnc_finder when parameter SS.features is set as TRUE.
This function depends on the program "RNAfold" of software "ViennaRNA". (http://www.tbi.univie.ac.at/RNA/index.html)
Parameter RNAfold.path can be simply defined as "RNAfold" as
default when the OS is UNIX/Linux. However, for some OS, such as Windows, users
need to specify the RNAfold.path if the path of "RNAfold" haven't been
added in environment variables.
This function can print the related information when the OS is UNIX/Linux, such as:
"25 of 100, length: 695 nt",
which means around 100 sequences are assigned to this node and the program is computing the 25th sequence. The length of this sequence is 695nt.
If users have their own SS data, users can use function read_SS to load
them, instead of obtaining from RNAfold.
Returns data.frame. The first row is RNA sequence; the second row is Dot-Bracket Notation of secondary structure sequences; the last row is minimum free energy (MFE).
HAN Siyu
## Not run: ### For a FASTA file contains several sequences, ### Use "read.fasta" function of package "seqinr" to read a FASTA file: Seqs <- read.fasta(file = "http://www.ncbi.nlm.nih.gov/WebSub/html/help/sample_files/nucleotide-sample.txt") ### Or just try to use our data "demo_DNA.seq" data(demo_DNA.seq) Seqs <- demo_DNA.seq ### Windows: RNAfold.path <- '"E:/Program Files/ViennaRNA/RNAfold.exe"' SS.seq_1 <- run_RNAfold(Seqs[1:2], RNAfold.path = RNAfold.path, parallel.cores = 2) ### For UNIX/Linux, "RNAfold.path" can be just defined as "RNAfold" as default: SS.seq_2 <- run_RNAfold(Seqs, RNAfold.path = "RNAfold", parallel.cores = 2) ## End(Not run)## Not run: ### For a FASTA file contains several sequences, ### Use "read.fasta" function of package "seqinr" to read a FASTA file: Seqs <- read.fasta(file = "http://www.ncbi.nlm.nih.gov/WebSub/html/help/sample_files/nucleotide-sample.txt") ### Or just try to use our data "demo_DNA.seq" data(demo_DNA.seq) Seqs <- demo_DNA.seq ### Windows: RNAfold.path <- '"E:/Program Files/ViennaRNA/RNAfold.exe"' SS.seq_1 <- run_RNAfold(Seqs[1:2], RNAfold.path = RNAfold.path, parallel.cores = 2) ### For UNIX/Linux, "RNAfold.path" can be just defined as "RNAfold" as default: SS.seq_2 <- run_RNAfold(Seqs, RNAfold.path = "RNAfold", parallel.cores = 2) ## End(Not run)
This function conduct k-fold Cross Validation for SVM.
svm_cv( dataset, label.col = 1, positive.class = NULL, folds.num = 10, seed = 1, parallel.cores = 2, ... )svm_cv( dataset, label.col = 1, positive.class = NULL, folds.num = 10, seed = 1, parallel.cores = 2, ... )
dataset |
The dataset obtained from function |
label.col |
integer specifying the column number of the label. (Default: |
positive.class |
Character. Indicate the positive class of the dataset.
(Default: |
folds.num |
Integer. Specify the number of folds for cross-validation.
(Default: |
seed |
Integer. Used to set the seed for cross-validation. (Default: |
parallel.cores |
Integer. The number of cores for parallel computation.
By default the number of cores is |
... |
additional parameters for function |
During the model tuning, the performance of each combination of parameters will output. Sensitivity, Specificity, Accuracy, F-Measure and Kappa Value are used to evaluate the performances. The best gamma and cost (or best model) are selected based on Accuracy.
For the details of parameter gamma and cost, please refer to function
svm of package "e1071".
For the details of metrics, please refer to function
confusionMatrix of package "caret".
Returns the optimal parameters when return.model = FALSE.
Or returns the best model when return.model = TRUE.
HAN Siyu
## Not run: data(demo_dataset) my_dataset <- demo_dataset cv_res <- svm_cv(my_dataset, folds.num = 4, seed = 1, parallel.core = 2, cost = 3, kernel = "radial", gamma = 0.5) ### Users can set return.model = TRUE to return the best model. ## End(Not run)## Not run: data(demo_dataset) my_dataset <- demo_dataset cv_res <- svm_cv(my_dataset, folds.num = 4, seed = 1, parallel.core = 2, cost = 3, kernel = "radial", gamma = 0.5) ### Users can set return.model = TRUE to return the best model. ## End(Not run)
This function conduct the parameter tuning of SVM. Parameters gamma and cost can be tuned using grid search.
svm_tune( dataset, label.col = 1, positive.class = "NonCoding", folds.num = 10, seed = 1, gamma.range = (2^seq(-5, 0, 1)), cost.range = c(1, 4, 8, 16, 24, 32), return.model = TRUE, parallel.cores = 2, ... )svm_tune( dataset, label.col = 1, positive.class = "NonCoding", folds.num = 10, seed = 1, gamma.range = (2^seq(-5, 0, 1)), cost.range = c(1, 4, 8, 16, 24, 32), return.model = TRUE, parallel.cores = 2, ... )
dataset |
The dataset obtained from function |
label.col |
integer specifying the column number of the label. (Default: |
positive.class |
Character. Indicate the positive class of the dataset.
(Default: |
folds.num |
Integer. Specify the number of folds for cross-validation.
(Default: |
seed |
Integer. Used to set the seed for cross-validation. (Default: |
gamma.range |
The range of gamma. (Default: |
cost.range |
The range of cost. (Default: |
return.model |
Logical. If |
parallel.cores |
Integer. The number of cores for parallel computation.
By default the number of cores is |
... |
Additional arguments for function |
During the model tuning, the performance of each combination of parameters will output. Sensitivity, Specificity, Accuracy, F-Measure and Kappa Value are used to evaluate the performances. The best gamma and cost (or best model) are selected based on Accuracy.
For the details of parameter gamma and cost, please refer to function
svm of package "e1071".
For the details of metrics, please refer to function
confusionMatrix of package "caret".
Returns the optimal parameters when return.model = FALSE.
Or returns the best model when return.model = TRUE.
HAN Siyu
## Not run: data(demo_DNA.seq) Seqs <- demo_DNA.seq positive_data <- extract_features(Seqs[1:5], label = "NonCoding", SS.features = FALSE, format = "DNA", frequencies.file = "human", parallel.cores = 2) negative_data <- extract_features(Seqs[6:10], label = "Coding", SS.features = FALSE, format = "DNA", frequencies.file = "human", parallel.cores = 2) my_dataset <- rbind(positive_data, negative_data) ### Or use our data "demo_dataset" data(demo_dataset) my_dataset <- demo_dataset optimal_parameter <- svm_tune(my_dataset, positive.class = "NonCoding", folds.num = 2, seed = 1, gamma.range = (2 ^ seq(-5, 0, 2)), cost.range = c(1, 8, 16), return.model = FALSE, parallel.core = 2) ### Users can set return.model = TRUE to return the best model. ## End(Not run)## Not run: data(demo_DNA.seq) Seqs <- demo_DNA.seq positive_data <- extract_features(Seqs[1:5], label = "NonCoding", SS.features = FALSE, format = "DNA", frequencies.file = "human", parallel.cores = 2) negative_data <- extract_features(Seqs[6:10], label = "Coding", SS.features = FALSE, format = "DNA", frequencies.file = "human", parallel.cores = 2) my_dataset <- rbind(positive_data, negative_data) ### Or use our data "demo_dataset" data(demo_dataset) my_dataset <- demo_dataset optimal_parameter <- svm_tune(my_dataset, positive.class = "NonCoding", folds.num = 2, seed = 1, gamma.range = (2 ^ seq(-5, 0, 2)), cost.range = c(1, 8, 16), return.model = FALSE, parallel.core = 2) ### Users can set return.model = TRUE to return the best model. ## End(Not run)